szlakach sygnałowych PRR i chorobach o podłożu immunologicznym

Stosunek białka C reaktywnego  do albuminy (CAR) jako predyktor nieszczelności zespolenia w chirurgii jelita grubego

Wstęp:  Nieszczelność zespolenia (AL) jest jednym z najpoważniejszych powikłań chirurgii jelita grubego. Obecnie nie są dostępne żadne biomarkery prognostyczne AL. Celem pracy było zbadanie roli białka C-reaktywnego (CRP) w stosunku do albumin (CAR) jako predyktora AL u pacjentów poddawanych planowej operacji z powodu raka jelita grubego.

Materiał i metody:  Zebrano dane dotyczące 1183 kolejnych pacjentów leczonych chirurgicznie z powodu histologicznie potwierdzonego raka jelita grubego na oddziałach chirurgicznych objętych badaniem. Dane obejmowały płeć, wiek, BMI, wynik ASA, wskaźnik współwystępowania Charlsona, lokalizację, histologię i stopień zaawansowania choroby, a także badania krwi, w tym albuminę i CRP w 4. dobie po operacji. Analizowano różnice w CAR pomiędzy pacjentami, u których rozwinął się AL i tymi, u których nie wystąpił AL, a zdolność CAR do przewidywania AL zbadano za pomocą analizy ROC.

Wyniki:  CAR był istotnie wyższy u pacjentów z AL w porównaniu z osobami bez AL w 4. dobie po operacji. W analizie ROC CAR wykazał dobrą zdolność wykrywania AL (AUC 0,825, 95% CI: 0,786-0,859), większą niż w przypadku samego CRP i albuminy. CAR wykazał również wysoką zdolność wykrywania zgonów pooperacyjnych (AUC 0,750, 95% CI 0,956-0,987). Wyniki te zostały potwierdzone w analizie wielowymiarowej obejmującej najistotniejsze czynniki ryzyka AL.

Wnioski:  Nasze badanie wykazało, że CAR, niedrogi i powszechnie dostępny biomarker laboratoryjny, odpowiednio przewiduje AL i zgon u pacjentów poddanych planowej operacji z powodu raka jelita grubego.

Doustne podawanie  białka  mózgowego w połączeniu z probiotykami indukuje tolerancję immunologiczną poprzez szlak tryptofanowy

Nadmierne zapalenie prowadzi do wtórnego uszkodzenia immunologicznego po urazowym uszkodzeniu mózgu (TBI). Błona śluzowa jelit jest kluczowym elementem tolerancji immunologicznej ze względu na regulację osi jelito-mózg, ale efekt leczniczy nie jest optymalny. Dysfunkcja jelit zaburza ustalenie tolerancji immunologicznej u pacjentów z TBI. Dlatego podaliśmy mózgowi doustniebiałko (BP) w połączeniu z probiotykami w celu wywołania tolerancji immunologicznej i zbadali mechanizm, dzięki któremu homeostaza mikroflory przyczynia się do wzmocnienia efektów leczniczych przez BP. Tutaj wykazaliśmy, że pacjenci z TBI i modelami chirurgicznego uszkodzenia mózgu (SBI) u szczurów mieli wyraźną dysbiozę. Warto zauważyć, że bariera jelitowa, cytokiny prozapalne i aktywacja mikrogleju wykazały, że nadmierne uszkodzenia zapalne były lepiej kontrolowane w grupie złożonej (doustne podawanie BP w połączeniu z probiotykami) niż w grupie BP (doustne podawanie BP). Zasadniczo analiza proteomiki ilościowej oparta na tandemowym znaczniku masy (TMT) wykazała, że ​​BP i probiotyki preferencyjnie wpływają na szlaki związane z Strive.

Seria eksperymentów potwierdziła ponadto, że ekspresja 2,three dioksygenazy indoloaminy (IDO) / kinureniny (Kyn) / receptora węglowodorów arylowych (AhR) była wysoka w grupie BP, podczas gdy hydroksylaza tryptofanu 1(TpH1)/5-hydroksytryptamina (5-HT ) zmienił się tylko w połączonej grupie. Badanie to sugeruje, że probiotyki mogą zwiększać skuteczność doustnej tolerancji immunologicznej wywołanej przez BP poprzez szlak Strive.

miroslawstraczynski
miroslawstraczynski

XPO6 Antibody

DF12799 200ul
EUR 304
Description: XPO6 Antibody detects endogenous levels of XPO6.

XPO6 Antibody

1-CSB-PA842747ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against XPO6. Recognizes XPO6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

XPO6 Antibody

1-CSB-PA026224GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against XPO6. Recognizes XPO6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

XPO6 Conjugated Antibody

C46712 100ul
EUR 397

anti- XPO6 antibody

FNab09550 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:10-1:100
  • IP: 1:200-1:1000
  • Immunogen: exportin 6
  • Uniprot ID: Q96QU8
  • Gene ID: 23214
  • Research Area: Signal Transduction
Description: Antibody raised against XPO6

XPO6 Rabbit pAb

A10401-100ul 100 ul
EUR 308

XPO6 Rabbit pAb

A10401-200ul 200 ul
EUR 459

XPO6 Rabbit pAb

A10401-20ul 20 ul
EUR 183

XPO6 Rabbit pAb

A10401-50ul 50 ul
EUR 223

XPO6 Blocking Peptide

DF12799-BP 1mg
EUR 195

XPO6 cloning plasmid

CSB-CL842747HU1-10ug 10ug
EUR 814
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2514
  • Sequence: atggcgtcagttaacggcagcagccagaactgtgtctcgggtcaggagcgcggccggctgggggtcctggccatgtcctgcatcaatgaactcatgtccaagaactgtgtgcctatggaatttgaggagtatttactgcgtatgttccagcagactttctacctcctgcagaaaa
  • Show more
Description: A cloning plasmid for the XPO6 gene.

XPO6 cloning plasmid

CSB-CL842747HU2-10ug 10ug
EUR 1202
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3378
  • Sequence: atggcatctgaagaagcctctctcagggcattggaaagtctgatgacagaattttttcacgattgtacaaccaatgaaagaaaacgtgagatagaggagcttcttaataactttgcccagcaaataggagcctggagattctgcctgtactttctctccagcactaggaatgact
  • Show more
Description: A cloning plasmid for the XPO6 gene.

Anti-XPO6 antibody

PAab09550 100 ug
EUR 355

Anti-XPO6 antibody

STJ112437 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the importin-beta family. Members of this family are regulated by the GTPase Ran to mediate transport of cargo across the nuclear envelope. This protein has been shown to mediate nuclear export of profilin-actin complexes. A pseudogene of this gene is located on the long arm of chromosome 14. Alternative splicing results in multiple transcript variants that encode different protein isoforms.

Anti-XPO6 antibody

STJ13100475 100 µl
EUR 427

Mouse XPO6 shRNA Plasmid

20-abx978151
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

XPO6 ELISA KIT|Human

EF004323 96 Tests
EUR 689

Exportin-6 (XPO6) Antibody

20-abx126798
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin 6 (XPO6) Antibody

20-abx112420
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin-6 (XPO6) Antibody

abx037309-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Exportin-6 (XPO6) Antibody

20-abx321354
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin-6 (XPO6) Antibody

abx239550-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human XPO6 shRNA Plasmid

20-abx958092
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Exportin 6 (XPO6) Protein

20-abx650936
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Xpo6 ORF Vector (Rat) (pORF)

ORF079217 1.0 ug DNA
EUR 506

XPO6 ORF Vector (Human) (pORF)

ORF011649 1.0 ug DNA
EUR 95

XPO6 ORF Vector (Human) (pORF)

ORF014966 1.0 ug DNA
EUR 354

Xpo6 ORF Vector (Mouse) (pORF)

ORF061968 1.0 ug DNA
EUR 506

cDNA Synthesis SuperMix

20-abx09801420ulSystems
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Evo? cDNA Kit

M1164-100
EUR 294

Evo? cDNA Kit

M1164-25
EUR 234

Novo? cDNA Kit

M1165-100
EUR 354

Novo? cDNA Kit

M1165-25
EUR 267

Evo? cDNA Supermix

M1168-100
EUR 381

Evo? cDNA Supermix

M1168-25
EUR 267

Novo? cDNA Supermix

M1169-100
EUR 441

Novo? cDNA Supermix

M1169-25
EUR 289

Human Exportin- 6, XPO6 ELISA KIT

ELI-17963h 96 Tests
EUR 824

Mouse Exportin- 6, Xpo6 ELISA KIT

ELI-51533m 96 Tests
EUR 865

Human Exportin-6 (XPO6) ELISA Kit

abx384332-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

XPO6 sgRNA CRISPR Lentivector set (Human)

K2650901 3 x 1.0 ug
EUR 339

Xpo6 sgRNA CRISPR Lentivector set (Rat)

K6323501 3 x 1.0 ug
EUR 339

Xpo6 sgRNA CRISPR Lentivector set (Mouse)

K4963501 3 x 1.0 ug
EUR 339

Human Exportin 6(XPO6)ELISA Kit

QY-E01489 96T
EUR 361

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

20-abx09801620ulSystems
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

20-abx09802120ulSystems
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

XPO6 sgRNA CRISPR Lentivector (Human) (Target 1)

K2650902 1.0 ug DNA
EUR 154

XPO6 sgRNA CRISPR Lentivector (Human) (Target 2)

K2650903 1.0 ug DNA
EUR 154

XPO6 sgRNA CRISPR Lentivector (Human) (Target 3)

K2650904 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6323502 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6323503 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6323504 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4963502 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4963503 1.0 ug DNA
EUR 154

Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4963504 1.0 ug DNA
EUR 154

XPO6 Protein Vector (Human) (pPB-C-His)

PV059861 500 ng
EUR 481

XPO6 Protein Vector (Human) (pPB-N-His)

PV059862 500 ng
EUR 481

XPO6 Protein Vector (Human) (pPM-C-HA)

PV059863 500 ng
EUR 481

XPO6 Protein Vector (Human) (pPM-C-His)

PV059864 500 ng
EUR 481

XPO6 Protein Vector (Human) (pPB-C-His)

PV046593 500 ng
EUR 329

XPO6 Protein Vector (Human) (pPB-N-His)

PV046594 500 ng
EUR 329

XPO6 Protein Vector (Human) (pPM-C-HA)

PV046595 500 ng
EUR 329

XPO6 Protein Vector (Human) (pPM-C-His)

PV046596 500 ng
EUR 329

XPO6 Protein Vector (Rat) (pPB-C-His)

PV316866 500 ng
EUR 1191

XPO6 Protein Vector (Rat) (pPB-N-His)

PV316867 500 ng
EUR 1191

XPO6 Protein Vector (Rat) (pPM-C-HA)

PV316868 500 ng
EUR 1191

XPO6 Protein Vector (Rat) (pPM-C-His)

PV316869 500 ng
EUR 1191

XPO6 Protein Vector (Mouse) (pPB-C-His)

PV247870 500 ng
EUR 1065

XPO6 Protein Vector (Mouse) (pPB-N-His)

PV247871 500 ng
EUR 1065

XPO6 Protein Vector (Mouse) (pPM-C-HA)

PV247872 500 ng
EUR 1065

XPO6 Protein Vector (Mouse) (pPM-C-His)

PV247873 500 ng
EUR 1065

Xpo6 3'UTR GFP Stable Cell Line

TU172394 1.0 ml Ask for price

XPO6 3'UTR GFP Stable Cell Line

TU078606 1.0 ml
EUR 1394

Xpo6 3'UTR Luciferase Stable Cell Line

TU122394 1.0 ml Ask for price

XPO6 3'UTR Luciferase Stable Cell Line

TU028606 1.0 ml
EUR 1394

Xpo6 3'UTR Luciferase Stable Cell Line

TU223481 1.0 ml Ask for price

Xpo6 3'UTR GFP Stable Cell Line

TU273481 1.0 ml Ask for price

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Rola białek TRIM   w szlakach sygnałowych PRR i chorobach o podłożu immunologicznym

Receptory rozpoznawania wzorców (PRR) są rodzajem cząsteczek rozpoznających , których ekspresja następuje głównie na komórkach wrodzonego układu odpornościowego. PRR rozpoznają jeden lub więcej rodzajów wzorców molekularnych związanych z patogenami (PAMP), indukując produkcję interleukiny (IL), czynnika martwicy nowotworu (TNF), interferonu (IFN) i innych powiązanych cytokin w celu zaostrzenia chorób o podłożu immunologicznym. Ścieżki sygnałowe PPR odgrywają ważną rolę zarówno we wrodzonym, jak i nabytym układzie odpornościowym i są łatwe do aktywacji lub regulacji.

Białka z motywem trójdzielnym (TRIM) to grupa wysoce konserwatywnych białek w strukturze. Większość białek TRIM zawiera domenę RING, która, jak się uważa, odgrywa rolę w ubikwitynacji. Białka TRIM są zaangażowane w odporność wirusową, reakcję zapalną, autofagię i wzrost guza. W tym przeglądzie skupiamy się na regulacji białek TRIM na szlakach sygnałowych PRR i ich roli w chorobach o podłożu immunologicznym.

Sonda do fluorescencyjnego obrazowania molekularnego o selektywności dla rozpuszczalnego białka zagregowanego tau

Rozpuszczalne formy zagregowanego nieprawidłowo sfałdowanego białka tau, ogólnie nazywane oligomerami, są uważane za najbardziej toksyczne gatunki różnych stanów składania, które są patologicznymi składnikami zaburzeń neurodegeneracyjnych. W związku z tym istnieje krytyczne zapotrzebowanie biomedyczne na sondy do obrazowania, które mogą je identyfikować i określać ilościowo. . Zaprojektowaliśmy i zsyntetyzowaliśmy nową sondę fluorescencyjną,  pTP-TFE,  dla której oceniono profile wiązania i selektywności względem zagregowanych białek tau i Aβ . Nasze wyniki pokazały,  PTP-TFE  selektywny względem wczesnych type rozpuszczalnych agregatów tau z wysokim powinowactwem stałe dysocjacji ( Ok  d ) = 66 nm, a dziesięciokrotnie selektywność w stosunku starsze włókienka tau.

Ponadto stwierdziliśmy, że  pTP-TFE  jest selektywny dla tau ponad agregatami Aβ i ma dobrą przepuszczalność komórek. Ta selektywność  pTP-TFE  wobec wczesnych type zagregowanego białka tau  ex vivo  została również poparta badaniami nad tkanką ludzkiego mózgu zawierającą patologię tau i Aβ. Zgodnie z naszą najlepszą wiedzą, jest to pierwsza cząsteczka fluorescencyjna, o której doniesiono, że ma taką formę profilu selektywności, co sugeruje, że  pTP-TFE  jest unikalnym kandydatem na sondę do opartego na obrazowaniu wykrywania wczesnych stadiów choroby Alzheimera i innych tauopatii.

Odtworzone płytki krwi poddane kriokonserwacji syntetyzują  białka  podczas krótkotrwałego przechowywania i pakowania określonego podzbioru w mikropęcherzyki

Wstęp:  Kriokonserwacja płytek krwi (PLT) może umożliwić wydłużenie ich okresu trwałości do lat w porównaniu do dni w przypadku płytek przechowywanych w płynie. Ze względu na ich silniejszy efekt hemostatyczny, rekonstytuowane kriokonserwowane płytki krwi (krio-PLT) byłyby w stanie wspomagać nagłe krwawienia. Ponieważ syntezę białek powiązano z funkcjami PLT, takimi jak tworzenie skrzepów i odpowiedzi immunologiczne, oceniano zdolność translacyjną rekonstytuowanych krio-PLT po rozmrożeniu i krótkotrwałym przechowywaniu.

Metody/materiały:  Płytki krwi zamrożono w -80°C z 5-6% DMSO. Po rozmrożeniu rekonstytuowano je w osoczu, a następnie podzielono na porcje (12 ml) do minitorebek i oceniono przez 24 h przechowywania w temperaturze pokojowej. Jedna seria służyła jako kontrola; do drugiej i trzeciej serii dodano albo 300 µM puromycyny (µm) albo 227 nM µm znakowane biotyną. Próbki badano pod kątem jakości in vitro i liczby mikropęcherzyków PLT metodą cytometrii przepływowej. Syntezę białek w krio-PLT oceniano przy użyciu zmodyfikowanej metody opartej na proteomice powstającego łańcucha związanej z puromycyną.

Wyniki:  Parametry in vitro rekonstytuowanych, a następnie przechowywanych płytek krwi były zgodne z wcześniej opublikowanymi wynikami. Analizy spektrometrii masowej wykazały, że 22 białka zostały zsyntetyzowane w PLT, a 13 z nich zaobserwowano w mikropęcherzykach płytek krwi (PMV).

Wniosek:  Cryo-PLT może syntetyzować białka po rekonstytucji i przechowywaniu . Odkrycie podzbioru tych białek w PMV sugeruje rolę w enkapsulacji pęcherzyków, prawdopodobnie w sposób selektywny. Ta obserwacja dostarcza nowych informacji na temat zdolności do syntezy białek w krio-PLT i potencjalnej regulacji pakowania białek do PMV.

Leave a Reply

Your email address will not be published. Required fields are marked *